The detailed information of tRNA gene sequence


Sequence ID>C019443
Genome IDCP000252
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesSyntrophus aciditrophicus SB
Start position on genome 739696
End posion on genome 739772
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
atccagagaa
tRNA gene sequence
GGGCCTATAGCTCAGTTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTAGTTCAAA
TCTACCTAGGCCCACCA
Downstream region at tRNA end position
agacaggcgt
Secondary structure (Cloverleaf model)
>C019443	Ile	GAT
                   a      ACCA agacaggcgt
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     A - T          T A
                    T     C C A T C     A
      T G A        A      | | | | |     A
    T       C T C G       G G T A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    C - G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK