The detailed information of tRNA gene sequence


Sequence ID>C025255
Genome IDCT971583
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 7803
Start position on genome 450991
End posion on genome 451062
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
ctggagtcaa
tRNA gene sequence
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC
CTAGCGGCCCAGttt
Downstream region at tRNA end position
tatgaggatt
Secondary structure (Cloverleaf model)
>C025255	Gln	TTG
                   a      Gttt tatgaggatt
                     T - A
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G A T C C     A
        G A        C      | | | | |     G
      T     A C C G       C T A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK