The detailed information of tRNA gene sequence


Sequence ID>C025278
Genome IDCT971583
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 7803
Start position on genome 1952298
End posion on genome 1952217
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
cgtcgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ctcttctccc
Secondary structure (Cloverleaf model)
>C025278	Leu	GAG
                   c      Attt ctcttctccc
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK