The detailed information of tRNA gene sequence


Sequence ID>C025290
Genome IDCT971583
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 7803
Start position on genome 428926
End posion on genome 428838
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
gcgggccgct
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGttg
Downstream region at tRNA end position
aattgaatcg
Secondary structure (Cloverleaf model)
>C025290	Ser	GCT
                   t      Gttg aattgaatcg
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK