The detailed information of tRNA gene sequence


Sequence ID>C025298
Genome IDBX548020
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8102
Start position on genome 331759
End posion on genome 331840
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
agtcgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCActc
Downstream region at tRNA end position
catttccttg
Secondary structure (Cloverleaf model)
>C025298	Leu	GAG
                   c      Actc catttccttg
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK