The detailed information of tRNA gene sequence


Sequence ID>C025313
Genome IDBX548020
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8102
Start position on genome 1982019
End posion on genome 1982107
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
tggagcctct
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGttt
Downstream region at tRNA end position
caaggtcttc
Secondary structure (Cloverleaf model)
>C025313	Ser	GCT
                   t      Gttt caaggtcttc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK