The detailed information of tRNA gene sequence


Sequence ID>w018066
Genome IDAASE01000037
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium ferrooxidans DSM 13031 [AASE]
Start position on genome 10268
End posion on genome 10346
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
gttttctatG
tRNA gene sequence
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG
TCCCCTCATTCACCCAT
Downstream region at tRNA end position
Gttttttggg
Secondary structure (Cloverleaf model)
>w018066	His	GTG
                   G      CCAT Gttttttggg
                     G - C
                     T - A
                     G - C
                     A - T
                     T   T
                     T - A
                     G - C          T G
                    T     T C C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK