The detailed information of tRNA gene sequence


Sequence ID>WENV016383
Genome IDAACY020462689
Search identical group
Phylum/ClassMarine microbial communities from Global Ocean Sampling (GOS)
Species
Start position on genome 1074
End posion on genome 1152
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
ctattattaT
tRNA gene sequence
AGTCCCTTAGCTCAGTTGGTTAGAGCGCTACACTGATAATGTAGAGGTCCGCAGTTCAAA
TCTGCGAGGGACTACGC
Downstream region at tRNA end position
Tagggggatt
Secondary structure (Cloverleaf model)
>WENV016383	Ile	GAT
                   T      ACGC Tagggggatt
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     T - A          T A
                    T     G C G T C     A
      T G A        A      | | | | |     A
    T       C T C G       C G C A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK