The detailed information of tRNA gene sequence


Sequence ID>C171056594
Genome IDCP017075
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesNovosphingobium resinovorum SA1 (CP017075)
Start position on genome 1592640
End posion on genome 1592564
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
gccttggtat
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACCA
Downstream region at tRNA end position
ccaccatttc
Secondary structure (Cloverleaf model)
>C171056594	Met	CAT
                   t      ACCA ccaccatttc
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK