| Sequence ID | >WENV180000153 |
| Genome ID | FLNU01000073 |
| Phylum/Class | [FLNU] bioreactor metagenome; Moose rumen |
| Species | |
| Start position on genome | 7008 |
| End posion on genome | 7081 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
tcaaaatgat |
| tRNA gene sequence |
GGTGCCATAGCTCAGTAGGTAGAGCATCGGACTGAAAATCCGTGTGTCCCCGGTTCGAAT |
| Downstream region at tRNA end position |
aaaagagggt |
| Secondary structure (Cloverleaf model) | >WENV180000153 Phe GAA
t ACag aaaagagggt
G - C
G - C
T - A
G - C
C - G
C - G
A - T T A
T G G T C C A
T G A A | | | | G
A C T C G C C C G G C
G | | | | T T
G G A G C
T A A GTGTC
T T
C - G
G - C
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |