| Sequence ID | >WENV180000386 |
| Genome ID | FLNU01002334 |
| Phylum/Class | [FLNU] bioreactor metagenome; Moose rumen |
| Species | |
| Start position on genome | 15894 |
| End posion on genome | 15812 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
tgtttgtgat |
| tRNA gene sequence |
GCCCAGGTGGCGGAATAGGTAGACGCGCTGGTCTCAAACACCAGTGCCGCGAGGCATGCC |
| Downstream region at tRNA end position |
attaaatgaa |
| Secondary structure (Cloverleaf model) | >WENV180000386 Leu CAA
t ACga attaaatgaa
G + T
C - G
C - G
C - G
A - T
G - C
G - C C G
T C G G C C A
T A A G | | | | | G
A G G C G G C C G G C
G | | | T T
G A C G C
T A G G TGCCGCGAGGCAT
C - G
T - A
G - C
G - C
T - A
C C
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |