| Sequence ID | >WENV180011468 |
| Genome ID | FLSK01003099 |
| Phylum/Class | [FLSK] metagenome; saliva |
| Species | |
| Start position on genome | 17557 |
| End posion on genome | 17641 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
gccaccattt |
| tRNA gene sequence |
GCGGGACTGGCGAAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGTG |
| Downstream region at tRNA end position |
tttatcgatt |
| Secondary structure (Cloverleaf model) | >WENV180011468 Leu TAG
t ACCA tttatcgatt
G - C
C - G
G - C
G - C
G - C
A - T
C - G T G
T C T C C C A
T A A G | | | | A
T A G C G G T G G G C
G | | | T T
G A C G C
T A G A CGCCGCGAGGTGT
C - G
C - G
A - T
G - C
A - T
T T
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |