| Sequence ID | >WENV180016323 |
| Genome ID | FSUR01000027 |
| Phylum/Class | [FSUR] metagenome; soil |
| Species | |
| Start position on genome | 2006 |
| End posion on genome | 1932 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
tcttggagat |
| tRNA gene sequence |
GGGCGCATAGCTCAGCGGGAGAGCACTACCTTGACATGGTAGGGGTCACAGGTTCAATCC |
| Downstream region at tRNA end position |
tctccatcat |
| Secondary structure (Cloverleaf model) | >WENV180016323 Val GAC
t ACCA tctccatcat
G - C
G - C
G - C
C - G
G - C
C - G
A - T C T
T T G T C C A
G A A | | | | | A
C C T C G A C A G G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
T - A
A - T
C - G
C - G
T T
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |