| Sequence ID | >WENV180017109 |
| Genome ID | FSWM01000357 |
| Phylum/Class | [FSWM] metagenome; soil |
| Species | |
| Start position on genome | 6329 |
| End posion on genome | 6255 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
cccaaggagc |
| tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGGGCGTTCGAATC |
| Downstream region at tRNA end position |
aatttcttcg |
| Secondary structure (Cloverleaf model) | >WENV180017109 Gly GCC
c TCCA aatttcttcg
G - C
C - G
G - C
G - C
G - C
C - G
G - C T A
T T C C G C A
G A A + | | | | G
G C T C G G G G C G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |