The detailed information of tRNA gene sequence


Sequence ID>WENV180017966
Genome IDFSXZ01000229
Search identical group
Phylum/Class[FSXZ] metagenome; soil
Species
Start position on genome 11714
End posion on genome 11787
Amino Acid Arg
Anticodon ACG
Upstream region at tRNA start position
agcgcagcac
tRNA gene sequence
GCTCCCGTGGTGAAACGGAAATCACGCCGGACTACGAATCCGGTGTTGAAGGTTCGAGTC
CTTCCGGGAGCACCc
Downstream region at tRNA end position
ctgctcagga
Secondary structure (Cloverleaf model)
>WENV180017966	Arg	ACG
                   c      ACCc ctgctcagga
                     G - C
                     C - G
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     C T T C C     A
      C A A        G      | | | | |     G
    G       A G T G       G A A G G     C
    G       | | | |                 T T
    A       T C A C
      A A          G     TGTT
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    A C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK