| Sequence ID | >WENV180018114 |
| Genome ID | FSYH01000159 |
| Phylum/Class | [FSYH] metagenome; soil |
| Species | |
| Start position on genome | 1703 |
| End posion on genome | 1775 |
| Amino Acid | Ile2 |
| Anticodon | CAT |
| Upstream region at tRNA start position |
tcccctgccc |
| tRNA gene sequence |
GGGCTTGTAGCTCAGCGGTTAGAGCAGGCGACTCATAATCGCTTGGTCGCGGGTTCAAAT |
| Downstream region at tRNA end position |
acgatcgtgt |
| Secondary structure (Cloverleaf model) | >WENV180018114 Ile2 CAT
c Attg acgatcgtgt
G - C
G - C
G - C
C - G
T - A
T + G
G - C T A
T C G C C C A
C G A A | | | | | A
G C T C G G C G G G C
G | | | | T T
T G A G C
T A A TGGTC
G + T
G - C
C - G
G - C
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |