| Sequence ID | >WENV180019416 |
| Genome ID | FTBV01002034 |
| Phylum/Class | [FTBV] metagenome; soil |
| Species | |
| Start position on genome | 2015 |
| End posion on genome | 1939 |
| Amino Acid | Ile2 |
| Anticodon | CAT |
| Upstream region at tRNA start position |
gcgggctcgt |
| tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGTTAGAGCAGAGGACTCATAATCCTTTGGTCGTTGGTTCAAG |
| Downstream region at tRNA end position |
cctggggtct |
| Secondary structure (Cloverleaf model) | >WENV180019416 Ile2 CAT
t ACCA cctggggtct
G + T
G - C
G - C
C - G
C - G
G - C
T - A T G
T C A A C C A
T G A A | | | | | A
T C T C G G T T G G C
G | | | | T T
G G A G C
T T A A TGGTC
G + T
A - T
G - C
G - C
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |