| Sequence ID | >WENV180040976 |
| Genome ID | LLBZ010031061 |
| Phylum/Class | [LLBZ] soil metagenome; soil from tomato rhizosphere |
| Species | |
| Start position on genome | 4590 |
| End posion on genome | 4663 |
| Amino Acid | Lys |
| Anticodon | TTT |
| Upstream region at tRNA start position |
gaatcaaaat |
| tRNA gene sequence |
GACTTGGTAGCTCAGTTGGTAGAGCACATCACTTTTAATGATGGGGTCCTGGGTTCGAGC |
| Downstream region at tRNA end position |
ttttttttat |
| Secondary structure (Cloverleaf model) | >WENV180040976 Lys TTT
t ACta ttttttttat
G - C
A - T
C - G
T + G
T - A
G - C
G - C C G
T G A C C C A
T G A A | | | | | G
T C T C G C T G G G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
A - T
T - A
C - G
A - T
C A
T A
T T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |