Sequence ID | >WENV180042358 |
Genome ID | LQAE01005322 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 346 |
End posion on genome | 271 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
caaaaaatat |
tRNA gene sequence |
GGCCCATTAGCTCAATTTGGCAGAGCAGCTGACTCTTAATCAGCGTGTTGAGGGTTCGAG |
Downstream region at tRNA end position |
taaaaacgac |
Secondary structure (Cloverleaf model) | >WENV180042358 Lys CTT t ACCt taaaaacgac G - C G + T C - G C - G C - G A - T T - A T G T C C C C C A T A A A | | | | G T C T C G G A G G G C T | | | | T T G G A G C G C A A GTGTT G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |