Sequence ID | >WENV180042374 |
Genome ID | LQAE01009152 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 78 |
End posion on genome | 152 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gcgcggcacc |
tRNA gene sequence |
GGGTGATTAGCTCAGTGGTAGAGCGCTTCGTTCACATCGAAGATGTCAGGAGTTCAAATC |
Downstream region at tRNA end position |
gattcaaggg |
Secondary structure (Cloverleaf model) | >WENV180042374 Val CAC c ACCA gattcaaggg G - C G - C G - C T - A G - C A - T T - A T A T T T C T C A G A A | + | | | A T C T C G A G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |