Sequence ID | >WENV180042390 |
Genome ID | LQAE01013398 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 285 |
End posion on genome | 361 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tatataagtg |
tRNA gene sequence |
GGGCTTGTAGCTCAGTTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGCTGTTCAAG |
Downstream region at tRNA end position |
ttttatgggg |
Secondary structure (Cloverleaf model) | >WENV180042390 Ile GAT g ACCA ttttatgggg G - C G - C G - C C - G T + G T - A G - C T G T C C G A C A T G A A | | | | | A T C T C G G G C T G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |