Sequence ID | >WENV180042391 |
Genome ID | LQAE01013398 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 368 |
End posion on genome | 443 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
accattttat |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGGAGAGCGCCGCCCTTGCAAGGCGGAGGTCATCGGTTCGAAC |
Downstream region at tRNA end position |
tattaagttc |
Secondary structure (Cloverleaf model) | >WENV180042391 Ala TGC t ACCA tattaagttc G - C G - C G + T G - C G - C A - T T - A C A T T T G C C A C G A A | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G G - C C - G C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |