Sequence ID | >WENV180042395 |
Genome ID | LQAE01013761 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 211 |
End posion on genome | 285 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
acattttaat |
tRNA gene sequence |
GGTTCGGTAGTTCAGTTGGTTAGAATACGTGCCTGTCACGCACGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
aaaagcctgt |
Secondary structure (Cloverleaf model) | >WENV180042395 Asp GTC t GCaa aaaagcctgt G - C G - C T - A T + G C - G G - C G - C T G T T G C C C A T G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G G - C T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |