Sequence ID | >WENV180042398 |
Genome ID | LQAE01014107 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 230 |
End posion on genome | 144 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
caatgacagt |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGGTAACACCCGTG |
Downstream region at tRNA end position |
tttttcccct |
Secondary structure (Cloverleaf model) | >WENV180042398 Leu GAG t ACCA tttttcccct G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGGTAACACCCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |