Sequence ID | >WENV180042400 |
Genome ID | LQAE01014297 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 240 |
End posion on genome | 316 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttttttttat |
tRNA gene sequence |
GGCGGTGTAGCTCAGTTGGTTAGAGCATCGGAATCATAATCCGAGTGTCCGGGGTTCAAG |
Downstream region at tRNA end position |
ttattagtga |
Secondary structure (Cloverleaf model) | >WENV180042400 Met CAT t ACCA ttattagtga G + T G - C C - G G - C G - C T + G G - C T G T G T C C C A T G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC T - A C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |