Sequence ID | >WENV180042421 |
Genome ID | LQAE01018177 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 46 |
End posion on genome | 134 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttttatagtt |
tRNA gene sequence |
AGAGGGTTGCCAGAGTTGGTCGAATGGACCGGTTTTGAAAACCGGCGAGGTTCACGCCTC |
Downstream region at tRNA end position |
ctattattaa |
Secondary structure (Cloverleaf model) | >WENV180042421 Ser TGA t GCCA ctattattaa A - T G - C A - T G - C G - C G - C T + G T A T T T C C C A T T G A G + | | | | G G G A C C G A G G G C G | | | T T T A T G G C G A A CGAGGTTCACGCCTCC C - G C - G G - C G - C T - A T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |