Sequence ID | >WENV180042424 |
Genome ID | LQAE01018443 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 151 |
End posion on genome | 77 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gcttcggcat |
tRNA gene sequence |
GGCCCGTTCGTCTATCGGTTAGGACGCCAGGTTTTCAACCTGGAAAGAGGGGTTCGATTC |
Downstream region at tRNA end position |
catgcctcaa |
Secondary structure (Cloverleaf model) | >WENV180042424 Glu TTC t GCCA catgcctcaa G + T G - C C - G C - G C - G G - C T - A T T T T C C C C A C T A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C T A G AAAG C - G C - G A - T G - C G - C T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |