Sequence ID | >WENV180042475 |
Genome ID | LQAF01000297 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 9734 |
End posion on genome | 9658 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ttttcagagt |
tRNA gene sequence |
CGGGATGTGGCTCAGTCTGGTAGAGCACAGCGTTCGGGACGCTGGGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
cttagaaata |
Secondary structure (Cloverleaf model) | >WENV180042475 Pro CGG t ACCA cttagaaata C - G G - C G - C G - C A - T T - A G - C T A T T C T C C A T G A G + | | | | A C C T C G G G A G G C T | | | | T T G G A G C G T A A GGGTC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |