Sequence ID | >WENV180042476 |
Genome ID | LQAF01000302 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 4417 |
End posion on genome | 4493 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cctgcaacat |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTAGCAGGTTCCGATCCTGTTGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
tccgcttttt |
Secondary structure (Cloverleaf model) | >WENV180042476 Arg CCG t GCCA tccgcttttt G - C C - G G - C C - G C - G C - G G - C T A T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | + T T G G A G T A T A A TGGTC G + T C - G A - T G - C G - C T T T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |