Sequence ID | >WENV180042501 |
Genome ID | LQAF01000489 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 3925 |
End posion on genome | 4000 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tttctatcaT |
tRNA gene sequence |
GCGCTCATAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
caaaaagagc |
Secondary structure (Cloverleaf model) | >WENV180042501 Arg TCT T AAac caaaaagagc G + T C - G G - C C - G T + G C - G A - T T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |