Sequence ID | >WENV180042502 |
Genome ID | LQAF01000503 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1142 |
End posion on genome | 1055 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aatacgaaac |
tRNA gene sequence |
GGTCAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATC |
Downstream region at tRNA end position |
atttcccttt |
Secondary structure (Cloverleaf model) | >WENV180042502 Ser GGA c GCCA atttcccttt G - C G - C T - A C - G A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A T G A G TATACGGCAACGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |