Sequence ID | >WENV180042520 |
Genome ID | LQAF01000860 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1656 |
End posion on genome | 1732 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ccgccttagt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACTTGCATGGGGTGCAAGGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
atttatgtcc |
Secondary structure (Cloverleaf model) | >WENV180042520 Pro GGG t ACCA atttatgtcc C - G G - C G - C G - C G + T C - G G - C T A T C G T C C A C G A A | | | | | A C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |