Sequence ID | >WENV180042521 |
Genome ID | LQAF01001043 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 201 |
End posion on genome | 277 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
cgcttttcaa |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAACGGACTCATAATCCGTTGGTCGCTGGTTCGAG |
Downstream region at tRNA end position |
tttctagtta |
Secondary structure (Cloverleaf model) | >WENV180042521 Ile2 CAT a ACCA tttctagtta G - C G - C G - C C - G C - G T + G A - T T G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T T A A TGGTC A - T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |