Sequence ID | >WENV180042523 |
Genome ID | LQAF01001288 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 268 |
End posion on genome | 193 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcctcggtta |
tRNA gene sequence |
GCCCGGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
ttacttcaaa |
Secondary structure (Cloverleaf model) | >WENV180042523 Phe GAA a ACCA ttacttcaaa G - C C - G C - G C - G G - C G - C A - T T T T C C G C C A T G A A | | + | | G C C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |