Sequence ID | >WENV180042526 |
Genome ID | LQAF01001420 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 31 |
End posion on genome | 106 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gcaaatgagc |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCACAGGTTCGAAT |
Downstream region at tRNA end position |
ctcatacctg |
Secondary structure (Cloverleaf model) | >WENV180042526 Lys TTT c ACCA ctcatacctg G - C G - C G - C T - A C - G G - C T - A T A T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |