Sequence ID | >WENV180042534 |
Genome ID | LQAF01002396 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1273 |
End posion on genome | 1349 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
tacagtttga |
tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCATAGGTTCAAA |
Downstream region at tRNA end position |
tttaagaaac |
Secondary structure (Cloverleaf model) | >WENV180042534 fMet CAT a ACCA tttaagaaac T T G - C C - G G - C G - C G - C G - C T A T T G T C C A T G A G | + | | | A C C G A G A T A G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |