Sequence ID | >WENV180042600 |
Genome ID | LQAF01011105 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 401 |
End posion on genome | 476 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agtattagtg |
tRNA gene sequence |
GCGGATGTAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTTGTCGCGGGTTCAATC |
Downstream region at tRNA end position |
tcttttctcg |
Secondary structure (Cloverleaf model) | >WENV180042600 His GTG g CCCA tcttttctcg G - C C - G G - C G + T A - T T - A G - C C T T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A C TTGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |