Sequence ID | >WENV180042644 |
Genome ID | LQAF01016547 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 206 |
End posion on genome | 131 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gtagttccgg |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCAAAT |
Downstream region at tRNA end position |
ctaccatacg |
Secondary structure (Cloverleaf model) | >WENV180042644 Glu TTC g ACCA ctaccatacg G + T T - A C - G C - G C - G C - G A - T T A T T C C C C A A G A C | | | | | A G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |