Sequence ID | >WENV180042651 |
Genome ID | LQAF01016688 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 84 |
End posion on genome | 159 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cccaccatgt |
tRNA gene sequence |
GGGGAATTAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
tatcttttca |
Secondary structure (Cloverleaf model) | >WENV180042651 Ala TGC t ACCA tatcttttca G - C G - C G + T G - C A - T A - T T - A C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |