Sequence ID | >WENV180042655 |
Genome ID | LQAG01000005 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 182362 |
End posion on genome | 182290 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taaaaattat |
tRNA gene sequence |
GCCGACGTGGCTCAATTGGCAGAGCAGCTGACTTGTAATCAGCAGGTTATCGGTTCGAGT |
Downstream region at tRNA end position |
aatatgctaa |
Secondary structure (Cloverleaf model) | >WENV180042655 Thr TGT t Tttg aatatgctaa G - C C - G C - G G - C A - T C - G G - C T G T T A G C C A T A A G | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |