Sequence ID | >WENV180042682 |
Genome ID | LQAG01000069 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 16416 |
End posion on genome | 16340 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aaaaagttcg |
tRNA gene sequence |
GGGGCTGTAGTAGAGTTGGTTACAACATCGGCCTGTCACGCCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
taatttaaaa |
Secondary structure (Cloverleaf model) | >WENV180042682 Asp GTC g GCCA taatttaaaa G - C G - C G - C G - C C - G T - A G - C T G T T G C C C A T G A A + | | | | G T G A T G G C G G G C G | | | T T G C A A C T T A A AGGTC T + G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |