Sequence ID | >WENV180042683 |
Genome ID | LQAG01000074 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 23993 |
End posion on genome | 24067 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gtttggatgc |
tRNA gene sequence |
AGGCACGTAGCTCAGTGGGAGAGCACTACCTTGACACGGTAGGGGTCGGCGGTTCAATCC |
Downstream region at tRNA end position |
gatgctgcat |
Secondary structure (Cloverleaf model) | >WENV180042683 Val GAC c ACCA gatgctgcat A - T G - C G - C C - G A - T C - G G - C C T T C C G C C A G A A | | | | | A T C T C G G G C G G C G | | | | T T G G A G C G A A GGGTC C - G T - A A - T C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |