Sequence ID | >WENV180042865 |
Genome ID | LQAG01008609 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 421 |
End posion on genome | 345 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ataatagtgc |
tRNA gene sequence |
GGAGCCGTAGTTAAGCTGGTTATAACGCCGGCCTGTCACGCCGGAGGCCGCGAGTTCGAG |
Downstream region at tRNA end position |
ctagaagatc |
Secondary structure (Cloverleaf model) | >WENV180042865 Asp GTC c GCCA ctagaagatc G - C G - C A - T G - C C - G C - G G - C T G T T G C T C A C G A A + | | | | G T A T T G G C G A G C G | | | | T T G T A A C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |