Sequence ID | >WENV180042892 |
Genome ID | LQAG01011910 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 183 |
End posion on genome | 259 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaacaaatgt |
tRNA gene sequence |
GGCGAGGTAGCTCAGTTGGTTAGAGCATACGGCTCATATCCGCAGAGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
cgattaaaat |
Secondary structure (Cloverleaf model) | >WENV180042892 Met CAT t ACCA cgattaaaat G + T G - C C - G G - C A - T G - C G - C T G T T C T C C A T G A A + | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A A GAGTC T - A A C C - G G - C G - C C T T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |