Sequence ID | >WENV180042986 |
Genome ID | LQAH01000071 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 3799 |
End posion on genome | 3725 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acctcgccga |
tRNA gene sequence |
TGGGGTATCGCCAAGCGGTAAGGCACCGGATTTTGATTCCGGCATTCCCAGGTTCGAATC |
Downstream region at tRNA end position |
catacagaaa |
Secondary structure (Cloverleaf model) | >WENV180042986 Gln TTG a GCCA catacagaaa T - A G - C G - C G - C G - C T - A A - T T A T G G T C C A G A C | | | | | G C A C C G C C A G G C G | | | T T G A G G C T A A CATTC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |