Sequence ID | >WENV180042992 |
Genome ID | LQAH01000084 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 33012 |
End posion on genome | 32937 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cgactacccT |
tRNA gene sequence |
GCGCCAATAGCTCAGTTGGATAGAGCAACAGCCTTCTAAGCTGTGGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
tttttaaaac |
Secondary structure (Cloverleaf model) | >WENV180042992 Arg TCT T ATaa tttttaaaac G + T C - G G - C C - G C - G A - T A - T T A T T C T C C A T G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A A GGGTC A - T C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |