Sequence ID | >WENV180043063 |
Genome ID | LQAH01000808 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 591 |
End posion on genome | 510 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttgtcgctac |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGGGCAGACTGTAAATCTGTTGTCTACGACTTCGAA |
Downstream region at tRNA end position |
agttaggata |
Secondary structure (Cloverleaf model) | >WENV180043063 Tyr GTA c Atta agttaggata G - C G - C A - T G - C G - C G - C G + T T A T C T T C C A T G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A G TGTCTACGACTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |