Sequence ID | >WENV180043080 |
Genome ID | LQAH01001495 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1249 |
End posion on genome | 1173 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ggcctcggtt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGTTTTGGGAACAGAGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
gatttcacca |
Secondary structure (Cloverleaf model) | >WENV180043080 Pro TGG t ACCA gatttcacca C - G G - C G - C G - C G - C C - G G - C T A T C T C T C A C G A A | + | | | G C C G C G G G G A G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C T - A T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |