Sequence ID | >WENV180043086 |
Genome ID | LQAH01001714 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 675 |
End posion on genome | 750 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cctctgcagt |
tRNA gene sequence |
GCCCCTATAGCTCAGCTGGTAGAGCAACTGATTTGTAATCAGTAGGTCCGCGGTTCGAGT |
Downstream region at tRNA end position |
cttcaccatc |
Secondary structure (Cloverleaf model) | >WENV180043086 Thr TGT t ACCA cttcaccatc G - C C - G C - G C - G C - G T + G A - T T G T G T G C C A C G A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |