Sequence ID | >WENV180043122 |
Genome ID | LQAH01002958 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2122 |
End posion on genome | 2047 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
atgtttatcc |
tRNA gene sequence |
GGGGGTGTAGCTCAGCTGGGAGAGCATCGGCTTTGCAAGCCGAGGGTCGTGGGTTCGAGC |
Downstream region at tRNA end position |
tatggtagac |
Secondary structure (Cloverleaf model) | >WENV180043122 Ala TGC c ACCA tatggtagac G - C G - C G + T G - C G - C T - A G - C C G T C T C C C A C G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |